Edit |   |
---|---|
Antigenic Specificity | IL-10 |
Clone | 15F9 |
Host Species | Mouse |
Reactive Species | chicken |
Isotype | n/a |
Format | unconjugated |
Size | 100ug |
Concentration | n/a |
Applications | WB (1:1000), ELISA |
Reviews / Ratings | If you have used this antibody, please help fellow researchers by submitting reviews to pAbmAbs and antYbuddY. |
Description | Anti-IL-10 [15F9] Antibody. Target: Interleukin 10. Epitope: ACATCCAACTGCTCAGCTCT |
Immunogen | Purified yeast chIL-10 |
Other Names | n/a |
Gene, Accession # | Accession: P22301, NM_001004414.2 |
Catalog # | EUS015 |
Price | $328 |
Order / More Info | IL-10 Antibody from KERAFAST, INC. |
Product Specific References |
|